Either a pre-prepared data frame, or characters which refer to mappings within an annotation pacakge
annotation
Optional character identifying the annotation of the ExpressionSetIllumina object. e.g. Humanv3, Mousev2.
Details
The function will identify which package should be used by concatenating the character string illumina with the value of the annotation slot of the object, or the annotation argument passed in. If this package is not installed on the users computer, then the function will fail.
Assuming the package has been correctly loaded, the character vector toAdd is converted to the names of environments within the package. These environments are then queried with the featureNames of the input object. The result of each query is converted to a data frame and merged with the original feature data of the object.
Alternatively, rather than querying from an annotation pacakge, a pre-prepared data frame can be used.
Value
An ExpressionSetIllumina object with modified featureData
R version 3.3.1 (2016-06-21) -- "Bug in Your Hair"
Copyright (C) 2016 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> library(beadarray)
Loading required package: BiocGenerics
Loading required package: parallel
Attaching package: 'BiocGenerics'
The following objects are masked from 'package:parallel':
clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
clusterExport, clusterMap, parApply, parCapply, parLapply,
parLapplyLB, parRapply, parSapply, parSapplyLB
The following objects are masked from 'package:stats':
IQR, mad, xtabs
The following objects are masked from 'package:base':
Filter, Find, Map, Position, Reduce, anyDuplicated, append,
as.data.frame, cbind, colnames, do.call, duplicated, eval, evalq,
get, grep, grepl, intersect, is.unsorted, lapply, lengths, mapply,
match, mget, order, paste, pmax, pmax.int, pmin, pmin.int, rank,
rbind, rownames, sapply, setdiff, sort, table, tapply, union,
unique, unsplit
Loading required package: Biobase
Welcome to Bioconductor
Vignettes contain introductory material; view with
'browseVignettes()'. To cite Bioconductor, see
'citation("Biobase")', and for packages 'citation("pkgname")'.
Loading required package: ggplot2
Welcome to beadarray version 2.22.2
beadarray versions >= 2.0.0 are substantial updates from beadarray 1.16.0 and earlier. Please see package vignette for details
> png(filename="/home/ddbj/snapshot/RGM3/R_BC/result/beadarray/addFeatureData.Rd_%03d_medium.png", width=480, height=480)
> ### Name: addFeatureData
> ### Title: Add probe data
> ### Aliases: addFeatureData
>
> ### ** Examples
>
>
> if(require(beadarrayExampleData)){
+
+ data(exampleSummaryData)
+
+ exampleSummaryData <- addFeatureData(exampleSummaryData)
+ head(fData(exampleSummaryData))
+ }
Loading required package: beadarrayExampleData
Loading required package: illuminaHumanv3.db
Loading required package: AnnotationDbi
Loading required package: stats4
Loading required package: IRanges
Loading required package: S4Vectors
Attaching package: 'S4Vectors'
The following objects are masked from 'package:base':
colMeans, colSums, expand.grid, rowMeans, rowSums
Loading required package: org.Hs.eg.db
Row.names ArrayAddressID IlluminaID Status SYMBOL
ILMN_1802380 ILMN_1802380 10008 ILMN_1802380 regular RERE
ILMN_1893287 ILMN_1893287 10010 ILMN_1893287 regular <NA>
ILMN_1736104 ILMN_1736104 10017 ILMN_1736104 regular <NA>
ILMN_1792389 ILMN_1792389 10019 ILMN_1792389 regular RNF165
ILMN_1854015 ILMN_1854015 10020 ILMN_1854015 regular <NA>
ILMN_1904757 ILMN_1904757 10021 ILMN_1904757 regular <NA>
PROBEQUALITY CODINGZONE
ILMN_1802380 Perfect Transcriptomic
ILMN_1893287 Bad Transcriptomic?
ILMN_1736104 Bad Intergenic
ILMN_1792389 Perfect Transcriptomic
ILMN_1854015 Bad Intergenic
ILMN_1904757 Perfect*** Transcriptomic?
PROBESEQUENCE
ILMN_1802380 GCCCTGACCTTCATGGTGTCTTTGAAGCCCAACCACTCGGTTTCCTTCGG
ILMN_1893287 GGATTTCCTACACTCTCCACTTCTGAATGCTTGGAAACACTTGCCATGCT
ILMN_1736104 TGCCATCTTTGCTCCACTGTGAGAGGCTGCTCACACCACCCCCTACATGC
ILMN_1792389 CTGTAGCAACGTCTGTCAGGCCCCCTTGTGTTTCATCTCCTGCGCGCGTA
ILMN_1854015 GCAGAAAACCATGAGCTGAAATCTCTACAGGAACCAGTGCTGGGGTAGGG
ILMN_1904757 AGCTGTACCGTGGGGAGGCTTGGTCCTCTTGCCCCATTTGTGTGATGTCT
>
>
>
>
>
>
> dev.off()
null device
1
>