Triplex search and visualization package

Description

This package provides functions for the identification and visualization of potential intramolecular triplex (H-DNA) patterns in DNA sequences.

Details

This package is essentially an R interface to the underlying C implementation of a dynamic-programming search startegy of the same name (Lexa et al., 2011). The main functionality of the original program was to detect the positions of subsequences in a much larger sequence capable of folding into an intramolecular triplex (H-DNA) made of as many cannonical nucleotide triplets as possible (see triplex.search). In creating its incarnation in R, we extended this basic functionality, to include the calculation of exact base-pairing in the triple helices, which allowed us to extend the functionality of the package towards visualization showing the exact base-pairing in 1D, 2D or 3D (see triplex.diagram and triplex.3D).

Author(s)

Matej Lexa, Tomas Martinek, Kamil Rajdl, Jiri Hon

Maintainer: Jiri Hon <jiri.hon@google.com>

References

Lexa, M., Martinek, T., Burgetova, I., Kopecek, D., Brazdova, M.: A dynamic programming algorithm for identification of triplex-forming sequences, In: Bioinformatics, Vol. 27, No. 18, 2011, Oxford, GB, p. 2510-2517, ISSN 1367-4803

See Also

DNAString, triplex.search, triplex.diagram, triplex.3D

Examples

seq <- DNAString("GGAAAGCAATGCCAGGCAGGG")
t <- triplex.search(seq, min_score=10, p_value=1)
triplex.diagram(t[1])
## Not run: 
triplex.3D(t[1])

## End(Not run)
triplex.score.table()
triplex.group.table()

Results

R version 3.3.1 (2016-06-21) -- "Bug in Your Hair"
Copyright (C) 2016 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> library(triplex)
Loading required package: S4Vectors
Loading required package: stats4
Loading required package: BiocGenerics
Loading required package: parallel

Attaching package: 'BiocGenerics'

The following objects are masked from 'package:parallel':

    clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
    clusterExport, clusterMap, parApply, parCapply, parLapply,
    parLapplyLB, parRapply, parSapply, parSapplyLB

The following objects are masked from 'package:stats':

    IQR, mad, xtabs

The following objects are masked from 'package:base':

    Filter, Find, Map, Position, Reduce, anyDuplicated, append,
    as.data.frame, cbind, colnames, do.call, duplicated, eval, evalq,
    get, grep, grepl, intersect, is.unsorted, lapply, lengths, mapply,
    match, mget, order, paste, pmax, pmax.int, pmin, pmin.int, rank,
    rbind, rownames, sapply, setdiff, sort, table, tapply, union,
    unique, unsplit


Attaching package: 'S4Vectors'

The following objects are masked from 'package:base':

    colMeans, colSums, expand.grid, rowMeans, rowSums

Loading required package: IRanges
Loading required package: XVector
Loading required package: Biostrings
> png(filename="/home/ddbj/snapshot/RGM3/R_BC/result/triplex/triplex-package.Rd_%03d_medium.png", width=480, height=480)
> ### Name: triplex-package
> ### Title: Triplex search and visualization package
> ### Aliases: triplex-package triplex
> ### Keywords: package
> 
> ### ** Examples
> 
> seq <- DNAString("GGAAAGCAATGCCAGGCAGGG")
> t <- triplex.search(seq, min_score=10, p_value=1)
Searching for triplex type 0...
Searching for triplex type 1...
Searching for triplex type 2...
Searching for triplex type 3...
Searching for triplex type 4...
Searching for triplex type 5...
Searching for triplex type 6...
Searching for triplex type 7...
> triplex.diagram(t[1])
  A DNAStringSet instance of length 4
    width seq                                               names               
[1]     8 CCCTGCCT                                          minus
[2]     8 GGGACGGA                                          plus
[3]     8 CCTTTCGT                                          para-minus
[4]     5 GGCAT                                             loop
> ## Not run: 
> ##D triplex.3D(t[1])
> ## End(Not run)
> triplex.score.table()
$par
   A  C  G  T
A -9 -9 -9 -9
C -9 -9  2 -9
G -9 -9  1  2
T  2  1  1 -9

$apar
   A  C  G  T
A  2 -9  1 -9
C  1 -9 -9 -9
G -9 -9  2 -9
T  2  1 -9 -9

> triplex.group.table()
$par
  A C G T
A 0 0 0 0
C 0 0 1 0
G 0 0 2 2
T 1 2 1 0

$apar
  A C G T
A 1 0 2 0
C 2 0 0 0
G 0 0 3 0
T 1 3 0 0

> 
> 
> 
> 
> 
> dev.off()
null device 
          1 
>