MassArray Data object

Description

This data contains MassArray spectral information for two samples.

Usage

MassArray.example.data

Format

The format is: Formal class 'MassArrayData' [package "MassArray"] with 17 slots ..@ sequence : chr "CCAGGTCCAAAGGTTCAGACCAGTCTGAACCTGTCCAGGGGCACTCCATATTTTCCTACCTGTCCCTCTTTGCTTGTAAAAACAAATTAAACAGGGATCCCAGCAACTTCGGGGCATGTGTGTAACT"| __truncated__ ..@ chr : chr(0) ..@ start : int(0) ..@ end : int(0) ..@ strand : chr "+" ..@ fwd.tag : chr "AGGAAGAGAG" ..@ rev.tag : chr "AGCCTTCTCCC" ..@ fwd.primer : num 29 ..@ rev.primer : num 27 ..@ lower.threshold : num 1500 ..@ upper.threshold : num 9000 ..@ fragments.T :List of 89 .. ..$ :Formal class 'MassArrayFragment' [package "MassArray"] with 21 slots .. .. .. ..@ ID : int 1 .. .. .. ..@ assay.name : chr "" .. .. .. ..@ name : chr "" .. .. .. ..@ sequence : chr "GGGAGAAGGCT" .. .. .. ..@ position : int 385 .. .. .. ..@ length : int 11 .. .. .. ..@ CpGs : int 0 .. .. .. ..@ MW : num 3913 .. .. .. ..@ collisions : int 0 .. .. .. ..@ collision.IDs :List of 1 .. .. .. .. ..$ : int(0) .. .. .. ..@ CG.collisions : int 0 .. .. .. ..@ CG.collision.IDs : list() .. .. .. ..@ type : chr "T" .. .. .. ..@ direction : chr "+" .. .. .. ..@ extra : chr "5PPP-3P" .. .. .. ..@ bisulfite.converted: logi TRUE .. .. .. ..@ assayable : logi TRUE .. .. .. ..@ conversion.control : logi FALSE .. .. .. ..@ required : logi FALSE .. .. .. ..@ ignored : logi FALSE .. .. .. ..@ primer : logi TRUE ..@ samples :List of 2 .. ..$ :Formal class 'MassArraySpectrum' [package "MassArray"] with 9 slots .. .. .. ..@ sample : chr "A" .. .. .. ..@ rxn : chr "T" .. .. .. ..@ strand : chr "+" .. .. .. ..@ peaks :List of 184 .. .. .. .. ..$ :Formal class 'MassArrayPeak' [package "MassArray"] with 16 slots .. .. .. .. .. .. ..@ ID : int 1 .. .. .. .. .. .. ..@ MW.theoretical : num 1111 .. .. .. .. .. .. ..@ MW.actual : num NA .. .. .. .. .. .. ..@ probability : num 0 .. .. .. .. .. .. ..@ SNR : num 0 .. .. .. .. .. .. ..@ height : num NA .. .. .. .. .. .. ..@ sample.intensity: num NA .. .. .. .. .. .. ..@ ref.intensity : num 0.1 .. .. .. .. .. .. ..@ sequence : chr "ACACAAT" .. .. .. .. .. .. ..@ adduct : chr "" .. .. .. .. .. .. ..@ type : chr "Modified" .. .. .. .. .. .. ..@ charge : int 1 .. .. .. .. .. .. ..@ collisions : int 0 .. .. .. .. .. .. ..@ components : int 0 .. .. .. .. .. .. ..@ missing : logi TRUE .. .. .. .. .. .. ..@ new : logi FALSE .. .. .. ..@ quality.conversion : num [1:4] 0.0529 0 0 0 .. .. .. ..@ quality.spectra : num NA .. .. .. ..@ quality.primerdimer: num [1:7] 8.51 15.83 3.28 1.04 0 ... .. .. .. ..@ quality.contaminant: num NA .. .. .. ..@ quality.adducts : num [1:114] 1 1 0.97 0.231 0.412 ... ..@ groups : chr(0) ..@ CpG.data : num [1:2, 1:18] 0.0322 0.0449 0.1468 0.3641 0.1468 ... ..@ CpG.data.combined: num [1:2, 1:18] 0.0322 0.0449 0.1468 0.3641 0.1468 ...

Source

Thompson et al. 2009

Examples

data(MassArray.example.data)

Results

R version 3.3.1 (2016-06-21) -- "Bug in Your Hair"
Copyright (C) 2016 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> library(MassArray)
> png(filename="/home/ddbj/snapshot/RGM3/R_BC/result/MassArray/MassArray.example.data.Rd_%03d_medium.png", width=480, height=480)
> ### Name: MassArray.example.data
> ### Title: MassArray Data object
> ### Aliases: MassArray.example.data
> ### Keywords: datasets
> 
> ### ** Examples
> 
> data(MassArray.example.data)
> 
> 
> 
> 
> 
> dev.off()
null device 
          1 
>